How to use miARmaSeq

In order to execute miARma-Seq, a configuration file in INI format is mandatory. This file should contain information about your experiment's setup. The general information section must in the heading [General] at the beginning of the configuration file. Although the general section is required for each analysis with miARma-Seq, a configuration file containing only this section, but missing remaining parameters will not be suffcient to perform any analysis. So, please make sure you check for this.
Below you will find different configuration files to run pipeline in order to analyse RNA-Seq from raw "fastq" files. First it perfoms a quality analysis, then performs a trimming step, followed by an alignment process, and a summarization step to count mapped reads for each genomic feature. Next it runs a differential expression analysis, and finally conducts miRNA-mRNA target prediction. Each section has different parameters that can be adjusted according to your particular experimental setup and needs. We encourage you to refer the complete guide in the documentation page or use our examples in the next page.

To perform a miRNAs analysis, you only need to define few parameters, according to the number of studies you want to perform. For instance, to run a complete analysis, you may need to follow six steps:

Quality Analisys [Quality]	To check the quality of the reads and potential sequencing errors
Trimming [Adapter]	To remove adapter sequences from sequenced reads
Alignment [Aligner]	Place reads into genomic postitions
Read summarization [ReadCount]	Count number of reads for each genomic feature
Differential expression Analysses [DEAnalysis]	Search for statiscally significant expression changes among group of samples
miRNA-mRNA target prediction [TargetPrediction]	Search for mRNAs subjected to differentially expressed miRNAs regulation

Below, an example of a mandatory configuration (.ini format) file ready to use with miARmaSeq:

[General]
; type of analysis (miRNA, mRNA or circRNA)
type=miRNA
; Complete path where your raw reads are stored
read_dir=/data/my_reads/
; label for the analsysis
label=Hypoxia
; Complete path where miARma has been installed
miARmaPath=/opt/miARma/
; Complete path to store results
output_dir=/data/my_results/
; organism used (common name eg:  mouse, fruitlfy, yeast ...)
organism=human
; Number of processes to run at the same time (adjust this value according to your hardware infrastructure and needs)
threads=4

[Quality]
; Select when quality should be performed (Previous to adapter removal, Post adapter process or both. Pre by default)
; Check section 4.1.2.2 from miRNA documentation for more details
Prefix=Pre

[Adapter]
; Specific software to remove the adapter from the sequences, CutAdapt by default
adaptersoft=CutAdapt
; if no adapter sequence is provided, it will predict an adapter to be removed. 

[Aligner]
; Aligner to use with miRNA (Bowtie1, Bowtie2, BWA or miRDeep)
aligner=Bowtie1
; Absolute path to Bowtie indexes files + Basename
bowtie1index=/Genomes/Indexes/bowtie1/human/bw1_homo_sapiens19

[ReadCount]
; Absolut path to GFF file used to calculate the number of reads in featureCounts analysis
database=/data/miRBase_Annotation_20_for_hsa_mature_miRNA.gtf
; GFF attribute to be used as feature ID (default: gene_id) for featureCounts analysis
seqid=transcript_id
; Feature type (3rd column in GFF file) to be used, all features of other type are ignored (default:exon) for featureCounts analysis
featuretype=miRNA

[DEAnalysis]
; Absolute path of the target file where group of sampes is detailed.
targetfile=/data/targets.txt
; Complete path of the contrast file where the comparison is specified (eg: Tumor-Health).
contrastfile=/data/contrast.txt

[TargetPrediction]

Once you have filled the file, you need to execute the pipeline by invoking:

$> ./miARma config_file.ini

The output should be similar to:

#########################################################################	
#   miARma, miRNA and RNASeq Multiprocess Analysis                      #
#                miARma v 1.5 (Apr-2016)                                #
#                                                                       #
#   Created at Computational Biology and Bioinformatics Group (CbBio)   #
#   Institute of Biomedicine of Seville. IBIS (Spain)                   #
#   Copyright (c) 2016 IBIS. All rights reserved.                       #
#   mail : miARma-devel@idoproteins.com                                 #
#########################################################################

[Wed Mar 16 07:44:01 2016] Starting a miARma analysis for miRNA
[Wed Mar 16 07:44:01 2016] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. 
[Wed Mar 16 07:44:01 2016] All parameters are correct.
[Wed Mar 16 07:44:01 2016] Starting Quality Analysis.
[Wed Mar 16 07:46:59 2016] Quality Analysis finished.
[Wed Mar 16 07:46:59 2016] Checking if files in folder: "my_reads/" are in the correct fastq format.
[Wed Mar 16 07:46:59 2016] Starting a Adapter removal analysis
[Wed Mar 16 07:50:53 2016] Adapter Analysis finished.
[Wed Mar 16 07:50:53 2016] Starting a "Bowtie1" Alignment Analysis
[Wed Mar 16 07:53:04 2016] "Bowtie1" Alignment Analysis finished
[Wed Mar 16 07:53:04 2016] Starting a Readcount Analysis
[Wed Mar 16 07:53:09 2016] Readcount Analysis finished.
[Wed Mar 16 07:53:10 2016] Starting a differential expression analysis using edgeR software(s)
[Wed Mar 16 07:53:16 2016] Differential expression analysis finished.
[Wed Mar 16 07:53:16 2016] Starting a target Prediction Analysis using miRGate
[Wed Mar 16 07:53:47 2016] Target Prediction Analysis finished.
[Wed Mar 16 07:53:47 2016] miARma finished. Job took 9 minutes

If you are interested in a miRNASeq study including the prediction of novel miRNAs (not stored in miRBase) and including a differential expression analisys and a miRNA-mRNA target prediction step, you can provide a confoguration file (ini format) with the following sections:

Quality Analisys [Quality]	To check the quality of the reads and potential sequencing errors
miRNA de Novo prediction [DeNovo]	To trimm + align and predict new miRNAs
Differential expression analisys [DEAnalysis]	Search for statiscally significant expression changes among group of samples
miRNA-mRNA target prediction [TargetPrediction]	Search for mRNAs subjected to differentially expressed miRNAs regulation

A template including suggested parameters is shown below:

[General]
; type of analysis (miRNA, mRNA or circRNA)
type=miRNA
; Complete path where your raw reads are stored
read_dir=/data/my_reads/
; label for the analsysis
label=Hypoxia
; Complete path where miARma has been installed
miARmaPath=/opt/miARma/
; Complete path to store results
output_dir=/data/my_results/
; organism used (common name eg:  mouse, fruitlfy, yeast ...)
organism=human
; Number of processes to run at the same time (adjust this value according to your hardware infrastructure and needs)
threads=4

[Quality]
; Select when quality should be performed, Previous to adapter removal by default)
; Check section 4.2.2.2 from miRNA documentation for more details
Prefix=Pre

[DeNovo]
;Indexed genome to align your reads in format .ebwt (MANDATORY FOR ANALYSIS WITH miRDeep)
bowtie1index=/Genomes/Indexes/bowtie1/human/bw1_homo_sapiens19
;Adapter to trimm at read 3'
adapter=ATCTCGTATGCCGTCTTCTGCTTGAA
;a fasta file with all mature sequence from your organism
mature_miRNA_file=/data/hsa_mature_miRBase20.fasta
;a fasta file with all known pre-miRNa sequence
precursor_miRNA_file=/data/precursors_miRBase20.fasta
;fasta file for the complete genome of our organism
genome=/Genomes/Indexes/bowtie1/human/homo_sapiens19.fa

[DEAnalysis]
; Complete path of the target file.
targetfile=/data/targets.txt
; Absolut path of the contrast file.
contrastfile=/data/contrast.txt

[TargetPrediction]

Once you have filled the file, you need to execute the pipeline by invoking:

$> ./miARma config_file.ini

The output should be similar to:

#########################################################################	
#   miARma, miRNA and RNASeq Multiprocess Analysis                      #
#                miARma v 1.5 (Apr-2016)                                #
#                                                                       #
#   Created at Computational Biology and Bioinformatics Group (CbBio)   #
#   Institute of Biomedicine of Seville. IBIS (Spain)                   #
#   Copyright (c) 2016 IBIS. All rights reserved.                       #
#   mail : miARma-devel@idoproteins.com                                 #
#########################################################################

[Sat Mar 19 23:14:37 2016] Starting a miARma analysis for miRNA
[Sat Mar 19 23:14:37 2016] Checking provided parameters for: Quality,DeNovo,DEAnalysis,TargetPrediction.
[Sat Mar 19 23:14:37 2016] All parameters are correct.
[Sat Mar 19 23:14:37 2016] Starting Quality Analysis.
[Sat Mar 19 23:15:41 2016] Quality Analysis finished.
[Sat Mar 19 23:15:41 2016] Starting a De novo identification and quantification of miRNAs
[Sun Mar 20 00:01:41 2016] De novo identification and quantification of miRNAs finished
[Sun Mar 20 00:01:41 2016] Starting a differential expression analysis using EdgeR-Noiseq software(s)
[Sun Mar 20 00:01:48 2016] Differential expression analysis finished.
[Sun Mar 20 00:01:48 2016] Starting a target Prediction Analysis using miRGate
[Sun Mar 20 00:03:59 2016] Target Prediction Analysis finished.
[Sun Mar 20 00:03:59 2016] miARma finished. Job took 49 minutes

RNASeq is used to analyze the continually changing cellular transcriptome as it reveals the presence and quantity of RNA in a biological samples at different timecouse.miARmaSeq enables looking for changes in gene expression:

Quality Analisys [Quality]	To check the quality of the reads and potential sequencing errors
Trimming [Adapter]	To remove adapter sequences/low quality nt from sequenced reads
Alignment [Aligner]	Place reads into genomic postitions
Read summarization [ReadCount]	Count number of reads for each genomic feature
Differential expression analisys [DEAnalysis]	Search for statiscally significant expression changes among group of samples
Functional Analysis [FAnalysis]	Enrichment studies including GO Terms and KEGG pathways.
miRNA-mRNA target prediction [TargetPrediction]	Search for miRNAs related to missregulated mRNAs

A template including suggested parameters is shown below:

[General]
; type of analysis (miRNA, mRNA or circRNA)
type=mRNA
; Folder for mRNA reads
; Complete path where your raw reads are stored
read_dir=/data/my_reads/
; label for the analsysis
label=TSA
; Complete path where miARma has been installed
miARmaPath=/opt/miARma/
; Complete path to store results
output_dir=/data/my_results/
; organism used (common name eg:  mouse, fruitlfy, yeast ...)
organism=human
; Number of processes to run at the same time (adjust this value according to your hardware infrastructure and needs)
threads=8

[Quality]
; Select when quality should be performed, Previous to adapter removal by default)
; Check section 4.2.2 from mRNA documentation for more details
Prefix=Pre

[Aligner]
; Aligner
aligner=tophat
; Tophat uses bowtie2 by default, bowtie1 can be also specified. miARmaSeq also allows to specify both: (Allowed values: Bowtie1, Bowtie2 and Bowtie1-Bowtie2/Bowtie2-Bowtie1)
tophat_aligner=Bowtie2
; Absolute path to indexed genome for Bowtie2 to align your reads in format .bt2 + Basename
bowtie2index=/Genomes/Indexes/bowtie2/human/bw2_homo_sapiens19
; Complete path to file used to hold information about gene structure (exos, introns, genes ..)
gtf=/data/Homo_sapiens_GRCh37.74_chr.gtf

[ReadCount]
; Complete path to GFF file used to calculate the number of reads in featureCounts analysis
database=/data/Homo_sapiens_GRCh37.74_chr.gtf

[DEAnalysis]
; Complete path of the target file.
targetfile=/data/targets.txt
; Whole path of the contrast file.
contrastfile=/data/contrast.txt

[FAnalysis]

[TargetPrediction]

Once you have filled the file, you need to execute the pipeline by invoking:

$> ./miARma config_file.ini

The output should be similar to:

#########################################################################	
#   miARma, miRNA and RNASeq Multiprocess Analysis                      #
#                miARma v 1.5 (Apr-2016)                                #
#                                                                       #
#   Created at Computational Biology and Bioinformatics Group (CbBio)   #
#   Institute of Biomedicine of Seville. IBIS (Spain)                   #
#   Copyright (c) 2016 IBIS. All rights reserved.                       #
#   mail : miARma-devel@idoproteins.com                                 #
#########################################################################

[Fri Mar 18 23:42:33 2016] Starting a miARma analysis for mRNA
[Fri Mar 18 23:42:33 2016] Checking provided parameters for: Quality,Aligner,ReadCount,DEAnalysis,FAnalysis,TargetPrediction. 
[Fri Mar 18 23:42:33 2016] All parameters are correct.
[Fri Mar 18 23:42:33 2016] Starting Quality Analysis.
[Fri Mar 18 23:43:38 2016] Quality Analysis finished.
[Fri Mar 18 23:43:38 2016] Starting a "tophat" Alignment Analysis
[Sat Mar 19 01:11:03 2016] "tophat" Alignment Analysis finished
[Sat Mar 19 01:11:03 2016] Starting a Readcount Analysis
[Sat Mar 19 01:12:28 2016] Readcount Analysis finished.
[Sat Mar 19 01:12:28 2016] Starting a differential expression analysis using edgeR software(s)
[Sat Mar 19 01:12:41 2016] Differential expression analysis finished.
[Sat Mar 19 01:12:41 2016] Starting a Functional Analysis.
[Sat Mar 19 01:13:26 2016] Functional Analysis finished.
[Sat Mar 19 01:13:26 2016] Starting a target Prediction Analysis using miRGate
[Sat Mar 19 01:23:45 2016] Target Prediction Analysis finished.
[Sat Mar 19 01:23:45 2016] miARma finished. Job took 101 minutes

Circular RNA (circRNA) is a novel type of RNA that, unlike linear RNA, forms a covalently closed continuous loop, some of which are highly represented in the eukaryotic transcriptome. They have been related to miRNA regulation increasing cancer development. miARma includes different analysis to study those RNAs, including:

Quality Analisys [Quality]	To check the quality of the reads and potential sequencing errors
Alignment [Aligner]	Place reads into genomic postitions
Read summarization [ReadCount]	Count number of reads for each genomic feature
Differential expression analisys [DEAnalysis]	Search for statiscally significant expression changes among group of samples

A template including suggested parameters is shown below:

[General]
; type of analysis (miRNA, mRNA or circRNA)
type=circRNA
; Complete path where your raw reads are stored
read_dir=/data/my_reads/
; label for the analsysis
label=Asthma
; Complete path where miARma has been installed
miARmaPath=/opt/miARma/
; Complete path to store results
output_dir=/data/my_results/
; organism used (common name eg:  mouse, fruitlfy, yeast ...)
organism=human
; Number of processes to run at the same time (adjust this value according to your hardware infrastructure and needs)
threads=6
;Type of sequencing ; could be Paired or Single. [Single by default]
seqtype=Paired

[Quality]

[Aligner]
; Aligner (BWA is highly recommended for circRNAs)
aligner=BWA
; Complete path to indexed genome from BWA to align your reads.
bwaindex=Genomes/Indexes/BWA/human/bwa_homo_sapiens19

[ReadCount]
; Whole path to GFF file used to calculate the number of reads in featureCounts analysis
database=Examples/basic_examples/circRNAs/data/Homo_sapiens_GRCh37.74_chr.gtf
; Absolute path to indexed genome to align your reads in format .ebwt (Mandatory for analysis with bowtie1)
fasta=Genomes/Indexes/BWA/human/bwa_homo_sapiens19.fa

[DEAnalysis]
; Complete path of the target file.
targetfile=/data/targets.txt
; Whole path of the contrast file.
contrastfile=/data/contrast.txt

Once you have filled the file, you need to execute the pipeline by invoking:

$> ./miARma config_file.ini

The output should be similar to:

#########################################################################	
#   miARma, miRNA and RNASeq Multiprocess Analysis                      #
#                miARma v 1.5 (Apr-2016)                                #
#                                                                       #
#   Created at Computational Biology and Bioinformatics Group (CbBio)   #
#   Institute of Biomedicine of Seville. IBIS (Spain)                   #
#   Copyright (c) 2016 IBIS. All rights reserved.                       #
#   mail : miARma-devel@idoproteins.com                                 #
#########################################################################

[Sat Mar 19 13:22:14 2016] Starting a miARma analysis for circRNA
[Sat Mar 19 13:22:14 2016] Checking provided parameters for: Quality,Aligner,ReadCount,DEAnalysis. 
[Sat Mar 19 13:22:14 2016] All parameters are correct.
[Sat Mar 19 13:22:14 2016] Starting Quality Analysis.
[Sat Mar 19 13:24:13 2016] Quality Analysis finished.
[Sat Mar 19 13:24:13 2016] Starting a "BWA" Alignment Analysis
[Sat Mar 19 13:54:43 2016] "BWA" Alignment Analysis finished
[Sat Mar 19 13:54:43 2016] Starting a Readcount Analysis
[Sat Mar 19 14:00:34 2016] Readcount Analysis finished.
[Sat Mar 19 14:00:34 2016] Starting a differential expression analysis using Noiseq software(s)
[Sat Mar 19 14:00:41 2016] Differential expression analysis finished.
[Sat Mar 19 14:00:41 2016] miARma finished. Job took 38 minutes